View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1867_low_31 (Length: 237)
Name: NF1867_low_31
Description: NF1867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1867_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 47484654 - 47484455
Alignment:
| Q |
18 |
tggattttactttcctttattgtttaagttaaaatttgcattttctttctctaggaagtaagcttatgtcatacgaaatcaacaattttgactatgatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47484654 |
tggattttactttcctttattgtttaagttaaaatttgcattttctttctctaggaagtaagcttatgtcatacgaaatcaacaattttgactatgatta |
47484555 |
T |
|
| Q |
118 |
tgtgacaatctcaacttgtcaacattcaaaaaattctttttaaggcttttttggc-aagatcaagaagctaactttatagcaggtatcttataaactctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47484554 |
tgtgacaatctcaacttgtcaacattcaaaaatttctttttaaggctcttttggcaaagatcaagaagctaactttatagcaggtatcttataaactctt |
47484455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University