View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1867_low_33 (Length: 227)
Name: NF1867_low_33
Description: NF1867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1867_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 27 - 104
Target Start/End: Complemental strand, 30729164 - 30729087
Alignment:
| Q |
27 |
ataaagacatgtatgtatgtgaaggagccagagggaatgttagaaaggcacaagaagaacaacaatatgatgaattca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30729164 |
ataaagacatgtatgtatgtgaaggagccagagggaatgttagaaaggcacaagaagaacaacaatatgatgaattca |
30729087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 171 - 210
Target Start/End: Complemental strand, 30729014 - 30728975
Alignment:
| Q |
171 |
gtgttgggttgaaatcccaataaataaatctgtggggggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30729014 |
gtgttgggttgaaatcccaataaataaatctgtggggggt |
30728975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University