View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1867_low_33 (Length: 227)

Name: NF1867_low_33
Description: NF1867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1867_low_33
NF1867_low_33
[»] chr4 (2 HSPs)
chr4 (27-104)||(30729087-30729164)
chr4 (171-210)||(30728975-30729014)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 27 - 104
Target Start/End: Complemental strand, 30729164 - 30729087
Alignment:
27 ataaagacatgtatgtatgtgaaggagccagagggaatgttagaaaggcacaagaagaacaacaatatgatgaattca 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30729164 ataaagacatgtatgtatgtgaaggagccagagggaatgttagaaaggcacaagaagaacaacaatatgatgaattca 30729087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 171 - 210
Target Start/End: Complemental strand, 30729014 - 30728975
Alignment:
171 gtgttgggttgaaatcccaataaataaatctgtggggggt 210  Q
    ||||||||||||||||||||||||||||||||||||||||    
30729014 gtgttgggttgaaatcccaataaataaatctgtggggggt 30728975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University