View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18680_low_5 (Length: 251)

Name: NF18680_low_5
Description: NF18680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18680_low_5
NF18680_low_5
[»] chr5 (1 HSPs)
chr5 (1-235)||(41213367-41213601)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 41213367 - 41213601
Alignment:
1 attccttgttttgggtaggagattcttggggannnnnnnnagtaaaaccactagggttttccctctgaattggggataaatttcggggtttagcacaatg 100  Q
    |||||||||||||| |||||||||||||||||        |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||    
41213367 attccttgttttggataggagattcttggggattttttttagtaaaaccactagggttttccctctaaatttgggataaatttcggggtttagcacaatg 41213466  T
101 tatagtgattcggatttagcagaggcaaaaacttttgagatatagtttctcgcaaaggagtagtgaacagaggatcaattggacatcttgtgggacttta 200  Q
    | ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41213467 tgtagcgattcggatttagcagaggcaaaaacttttgaggtatagtttctcgcaaaggagtagtgaacagaggatcaattggacatcttgtgggacttta 41213566  T
201 tcttgttatttgaagaagaagggtttgaaaagaac 235  Q
    |||||||||||||||||||||||||||||||||||    
41213567 tcttgttatttgaagaagaagggtttgaaaagaac 41213601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University