View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18680_low_5 (Length: 251)
Name: NF18680_low_5
Description: NF18680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18680_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 41213367 - 41213601
Alignment:
| Q |
1 |
attccttgttttgggtaggagattcttggggannnnnnnnagtaaaaccactagggttttccctctgaattggggataaatttcggggtttagcacaatg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
41213367 |
attccttgttttggataggagattcttggggattttttttagtaaaaccactagggttttccctctaaatttgggataaatttcggggtttagcacaatg |
41213466 |
T |
|
| Q |
101 |
tatagtgattcggatttagcagaggcaaaaacttttgagatatagtttctcgcaaaggagtagtgaacagaggatcaattggacatcttgtgggacttta |
200 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41213467 |
tgtagcgattcggatttagcagaggcaaaaacttttgaggtatagtttctcgcaaaggagtagtgaacagaggatcaattggacatcttgtgggacttta |
41213566 |
T |
|
| Q |
201 |
tcttgttatttgaagaagaagggtttgaaaagaac |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41213567 |
tcttgttatttgaagaagaagggtttgaaaagaac |
41213601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University