View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18680_low_6 (Length: 241)
Name: NF18680_low_6
Description: NF18680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18680_low_6 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 19428434 - 19428657
Alignment:
| Q |
19 |
ggtgttacttaaatgtttcagattctacataactttttgcttgttgttcttggtatctactgtttgcatgattgcatgatgacataacaatgtacattgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19428434 |
ggtgttacttaaatgtttcagattctacataactttttgcttcttgttcttggtatctactgtttgcatgattgcatgatgacataacaatgaacattgg |
19428533 |
T |
|
| Q |
119 |
aatgctatgattcaa-ttttttaaaccaaattcttcgatctctttttaccagcttctgcaaaaacaatactctggatcctaccttaatcaatggaagaat |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
19428534 |
aatgctatgattcaatttttttaaaccaaatttttcgatctctttttaccagcttctgcaagaacaatactctagatcctaccttaatcaatggaaaaat |
19428633 |
T |
|
| Q |
218 |
tgttatatgcacaattgaaagctt |
241 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
19428634 |
tgttatatgcacaatcgaaagctt |
19428657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 241
Target Start/End: Original strand, 19421774 - 19421893
Alignment:
| Q |
124 |
tatgattcaattttttaaaccaaattcttcgatctctttt--taccagcttctgcaaaaacaatactctggatcctaccttaatcaatggaagaattgtt |
221 |
Q |
| |
|
|||||||||||||| ||| ||||||||| || |||| | ||||||||||||||| ||||||||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
19421774 |
tatgattcaattttctaatacaaattctttaatatcttctgttaccagcttctgcaagaacaatactctagatccttccttaatcaatggaaaaattgtt |
19421873 |
T |
|
| Q |
222 |
atatgcacaattgaaagctt |
241 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
19421874 |
atatgcacaattgaaagctt |
19421893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University