View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18680_low_6 (Length: 241)

Name: NF18680_low_6
Description: NF18680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18680_low_6
NF18680_low_6
[»] chr4 (2 HSPs)
chr4 (19-241)||(19428434-19428657)
chr4 (124-241)||(19421774-19421893)


Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 19428434 - 19428657
Alignment:
19 ggtgttacttaaatgtttcagattctacataactttttgcttgttgttcttggtatctactgtttgcatgattgcatgatgacataacaatgtacattgg 118  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
19428434 ggtgttacttaaatgtttcagattctacataactttttgcttcttgttcttggtatctactgtttgcatgattgcatgatgacataacaatgaacattgg 19428533  T
119 aatgctatgattcaa-ttttttaaaccaaattcttcgatctctttttaccagcttctgcaaaaacaatactctggatcctaccttaatcaatggaagaat 217  Q
    ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |||    
19428534 aatgctatgattcaatttttttaaaccaaatttttcgatctctttttaccagcttctgcaagaacaatactctagatcctaccttaatcaatggaaaaat 19428633  T
218 tgttatatgcacaattgaaagctt 241  Q
    ||||||||||||||| ||||||||    
19428634 tgttatatgcacaatcgaaagctt 19428657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 241
Target Start/End: Original strand, 19421774 - 19421893
Alignment:
124 tatgattcaattttttaaaccaaattcttcgatctctttt--taccagcttctgcaaaaacaatactctggatcctaccttaatcaatggaagaattgtt 221  Q
    |||||||||||||| |||  |||||||||  || |||| |  ||||||||||||||| ||||||||||| |||||| ||||||||||||||| |||||||    
19421774 tatgattcaattttctaatacaaattctttaatatcttctgttaccagcttctgcaagaacaatactctagatccttccttaatcaatggaaaaattgtt 19421873  T
222 atatgcacaattgaaagctt 241  Q
    ||||||||||||||||||||    
19421874 atatgcacaattgaaagctt 19421893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University