View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18682_high_17 (Length: 243)
Name: NF18682_high_17
Description: NF18682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18682_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 15627 - 15424
Alignment:
| Q |
18 |
aagaaaggaggaaggaatcagcacaaccgaattgaataattaattnnnnnnnnnnnnnnngggaaggaaggaaggaagtatctaacgttgagattccaga |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15627 |
aagaaaggaagaaggaatcagcacaaccgaattgaataattaattaaaaaaaaaaaa------aaggaaggaaggaagtatctaacgttgagattccaga |
15534 |
T |
 |
| Q |
118 |
tttgccatgtgcatcataagcttgcctttgagttgggtcactgagaacttggtaagcttcgcctaaaacctaaaa-----caaagcaaagcagtggtaga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
15533 |
tttgccatgtgcatcataagcttgcctttgagttgggtcgctgagaacttggtaagcttcccctaaaacctaaaacaaagcaaagcaaagcagtggtaga |
15434 |
T |
 |
| Q |
213 |
tagatgggtc |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
15433 |
tagatgggtc |
15424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University