View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18682_high_18 (Length: 243)
Name: NF18682_high_18
Description: NF18682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18682_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 228
Target Start/End: Complemental strand, 53299010 - 53298793
Alignment:
| Q |
14 |
attattcttataatagaggcttgattat---atttcattatctagttcaagtcatttattggtcagacaaacaaagcacgacctgtaccnnnnnnnaatg |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
53299010 |
attattcttataatggaggcttgattattatatttcattatctagttcaagtcatttattggtcagacaaacaaagcacgacctttacctttttttaatg |
53298911 |
T |
 |
| Q |
111 |
ccatgaaatgctatttttaagcgaattccatgacttctttaaattaacagagcatacacaaatctgaattcgtaatctccacttccaaatatatctcaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53298910 |
ccatgaaatgctatttttaagcgaattccatgacttctttaaattaacagagcatacacaaatctgaattcgtaatctccacttccaaatatatctcaaa |
53298811 |
T |
 |
| Q |
211 |
tcattaattagttgtatc |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53298810 |
tcattaattagttgtatc |
53298793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University