View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18682_high_19 (Length: 240)
Name: NF18682_high_19
Description: NF18682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18682_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 7 - 117
Target Start/End: Complemental strand, 1996244 - 1996134
Alignment:
| Q |
7 |
gttgaagtttcaggtctatttatgatcagatggacattttggataaatatattgtttatataaaaaatttaagagatcgtgtttatacaagttggaattt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1996244 |
gttgaagtttcaggtctatttatgatcagatggacattttgaataaatatattgtttatataaaaaatttaagagatcgtgtttatacaagttggaattt |
1996145 |
T |
 |
| Q |
107 |
aaattttatgc |
117 |
Q |
| |
|
||||||||||| |
|
|
| T |
1996144 |
aaattttatgc |
1996134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 1996069 - 1996011
Alignment:
| Q |
182 |
gaaaagtaaatcgcgttaacacatttttagggaaaatcaaattaacattgaccgaaatt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1996069 |
gaaaagtaaatcgcgttaacacatttttagggaaaatcaaattaacattgaccgaaatt |
1996011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University