View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18682_low_11 (Length: 345)
Name: NF18682_low_11
Description: NF18682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18682_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 20 - 181
Target Start/End: Complemental strand, 1387315 - 1387154
Alignment:
| Q |
20 |
tgcgatctgttttgacgatggttttctttccattgttttaaagttattaggaaatcatccataggtggtacttttgaacaatcacaaaattcttcgatgg |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1387315 |
tgcgatctgttttgacgacggttttctttccattgttttaaagttattaggaaatcatccataggtggtacttttgaacaatcacaaaattcttcgatgg |
1387216 |
T |
|
| Q |
120 |
ttttatcagaaaattcatttaggccaattgtaaaacctgtgaaaaaacaagcaaatggaagg |
181 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1387215 |
ttctatcagaaaattcatttaggccaattgtaaaacctgtgaaaaaacaagcaaatggaagg |
1387154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 246 - 337
Target Start/End: Complemental strand, 1387088 - 1386994
Alignment:
| Q |
246 |
attaagcgtataatatta---cctgctgcagtgctgttatgcttctctatgagttccaactccatcttgaatatttctttgcgtctcttcatctc |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1387088 |
attaagcgtataatattattacctgctgcagtgctgttatgcttctctatgagttccaactccatcttgaatatttctttgcgtctcttcatctc |
1386994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 258 - 338
Target Start/End: Original strand, 23698193 - 23698273
Alignment:
| Q |
258 |
atattacctgctgcagtgctgttatgcttctctatgagttccaactccatcttgaatatttctttgcgtctcttcatctca |
338 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||| |||||| | |||||||||||||||||||| | ||||||||| |
|
|
| T |
23698193 |
atattacctgcagctgtgctgttaaagttctctatggattccaaggtcttcttgaatatttctttgcgtattttcatctca |
23698273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University