View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18682_low_16 (Length: 285)
Name: NF18682_low_16
Description: NF18682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18682_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 63 - 282
Target Start/End: Original strand, 4831291 - 4831518
Alignment:
| Q |
63 |
ttgaacatctacaaacttttacacgattcagaatcaaaccattaatcaacaagaactaactacactcagtcagtaacatattaaattaaaggatgattca |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4831291 |
ttgaacatctacaaacttttacacgattcagaatcaaaccattaatcaacaagaactaactacactcagtcagtaacat-----attaaaggatgattca |
4831385 |
T |
 |
| Q |
163 |
attattaaaagttacaatgaatgattgagcagtt-------------gtcgaaagattcaaaatttgacaaaatataaagaaatggggtgtctactttac |
249 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||| ||||||||||| | |
|
|
| T |
4831386 |
attattagaagttacaatgaatgattgagcagttaacacaataccaagtcgaaagattcaaaatttgacaaaatatgaggaaatggtgtgtctacttttc |
4831485 |
T |
 |
| Q |
250 |
acacttcaagagggaaatgaaggaatgattgga |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4831486 |
acacttcaagagggaaatgaaggaatgattgga |
4831518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University