View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18682_low_17 (Length: 282)
Name: NF18682_low_17
Description: NF18682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18682_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 9 - 261
Target Start/End: Complemental strand, 27422821 - 27422569
Alignment:
| Q |
9 |
agcagagaaaagcatggtaaactattgtaatgaaaaggctcaaagggactaatatggtatccaaataaataccttctcccatcttccttagtgatgaagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27422821 |
agcagagaaaagcatggtaaactattgtaatgaaaaggctcaaagggactaatatggtatccaaataaataccttctcccatcttccttagtgatgaagc |
27422722 |
T |
|
| Q |
109 |
aagaaaaaagcacctaaattatggccttaggggttggtttggttggtaaccttgaatgaaatgcgatggcttcttataatggactcttctcatataatgc |
208 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27422721 |
aagaaaaaagcacttaaattttggccttaggggttggtttggttggtaaccttgaatgaaatgtgatggcttcttataatggactcttctcatatagtgc |
27422622 |
T |
|
| Q |
209 |
aatggaaagctagcataacgtataataacaaaatgaacagttcacaaggtatt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27422621 |
aatggaaagctagcataacgtataataacaaaatgaacagttcacaaggtatt |
27422569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University