View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18682_low_22 (Length: 238)
Name: NF18682_low_22
Description: NF18682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18682_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 14442777 - 14442991
Alignment:
| Q |
18 |
gctaccaccaccatcaaccaccgtcacaaccaccgtcaggaatggtgcaaactcatcgtgcccgtcgtggtactcgccgttcacgcgcttccagttctac |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||| | |
|
|
| T |
14442777 |
gctaccaccaccatcaaccaccatcacaaccaccgtcaggaatggtgcaaactcaccgtgcccgtcgtggcactcgccgttcacgcgcttccgtttcttc |
14442876 |
T |
 |
| Q |
118 |
ttct------attgttagggtttccgataccgaacaaccgccgcaacagcagcaacaactacctaatcgatctccttgcactgattacgatatggcgtat |
211 |
Q |
| |
|
|||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14442877 |
ttcttcttccactgttagggtttccgatacagaacaaccgccgcaacagcagcaacaactacctaatcgatctccttgcactgattacgatatggcgtat |
14442976 |
T |
 |
| Q |
212 |
tttcattcctatgct |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14442977 |
tttcattcctatgct |
14442991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University