View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18682_low_9 (Length: 355)
Name: NF18682_low_9
Description: NF18682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18682_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 38 - 349
Target Start/End: Original strand, 21675192 - 21675502
Alignment:
| Q |
38 |
ttggggtttcaacaacactgtctacttttactcctactcctaagactacaatannnnnnncttccgctctttcatcaaggatattgtttagtttctaact |
137 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21675192 |
ttggggtttcagcaacactatctacttctactcctactcctaagactacaatatttttttcttccgctctttcatcaaggc-attgtttagtttctaact |
21675290 |
T |
|
| Q |
138 |
ccttattatgttgttcaaccgctttttccatatagttctcatatcattttagatgatatgcattgagatgagactctatgttttggcttgagacatgata |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21675291 |
ccttattatgttgttcaaccgctttttccatatagttctcatctcattttagatgatatgcattgagatgagactctatgttttggcttgagacatgata |
21675390 |
T |
|
| Q |
238 |
tgcctcaatacttttattgatagaattgcttgactatttagattggatcaagaaactgtttagcataagagccaagtttcctaccaactccatactctct |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21675391 |
tgcctcaatacttttattgatagaattgcttgactattcagattggatcaagaaactgtttagcataagagccaagttttctaccaactccatactctct |
21675490 |
T |
|
| Q |
338 |
tcctcttgttca |
349 |
Q |
| |
|
|||||||||||| |
|
|
| T |
21675491 |
tcctcttgttca |
21675502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University