View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18683_high_42 (Length: 271)

Name: NF18683_high_42
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18683_high_42
NF18683_high_42
[»] chr7 (3 HSPs)
chr7 (1-95)||(760842-760936)
chr7 (21-75)||(1408955-1409009)
chr7 (1-34)||(704534-704567)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 9e-42; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 760842 - 760936
Alignment:
1 tgataatcagatccctattatgataatgactgagcttataaattctggtatgaatgacaaggctgccactgtttttaccttagccaatgaatctc 95  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
760842 tgataatcaaatccctattatgataatgactgagcttataaattctggtatgaatgacaaggctgccactgtttttaccttagccaatggatctc 760936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 75
Target Start/End: Complemental strand, 1409009 - 1408955
Alignment:
21 tgataatgactgagcttataaattctggtatgaatgacaaggctgccactgtttt 75  Q
    ||||||||||||||||||||||||||||||||| |||  |||||| |||||||||    
1409009 tgataatgactgagcttataaattctggtatgactgatgaggctgtcactgtttt 1408955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 704567 - 704534
Alignment:
1 tgataatcagatccctattatgataatgactgag 34  Q
    ||||||||| ||||||||||||||||||||||||    
704567 tgataatcaaatccctattatgataatgactgag 704534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University