View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_high_49 (Length: 248)
Name: NF18683_high_49
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_high_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 39934833 - 39935069
Alignment:
| Q |
1 |
gttgtgaagtgtgatggtagagtgtatatgcttttggaaaagcgatcgactaccaccactaagatgattgtgtacgcattggaagatggcagtcccgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934833 |
gttgtgaagtgtgatggtagagtgtatatgcttttggaaaagcgatcgactaccaccactaagatgattgtgtacgcattggaagatggcagtcccgtga |
39934932 |
T |
|
| Q |
101 |
tgaaatctaatgaaatatcctcccaaacattggc-----tggaataggaaggggctatagaagaccaacggggcttggtgtcgtacttggtagttggtat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39934933 |
tgaaatctaatgaaatatcctcccaaacattggctggaatggaataggaaggggctatagaagaccaacggggcttggtgtcgtac-------ttggtat |
39935025 |
T |
|
| Q |
196 |
gttgacaaatcacaaaattcttgataaaactttgaatgtctctg |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39935026 |
gttgacaaatcacacaattcttgataaaactttgaatgtctctg |
39935069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University