View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_high_57 (Length: 231)
Name: NF18683_high_57
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_high_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 20 - 169
Target Start/End: Complemental strand, 27541373 - 27541224
Alignment:
| Q |
20 |
gatggctacttgaacagaaggnnnnnnnngaggatatggttaaaaagacagacaagtaatgtatggttgtaatggccatctatgagactattcccaccat |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27541373 |
gatggctacttgaacagaagggaaaaaaagaggatatggttaaaaagacagacaagtaatgtatggttgtaatggccatctatgagactattcccaccat |
27541274 |
T |
|
| Q |
120 |
cagcaatttggataagccaagctaagtaatgagaaccgaaccaagtgttg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27541273 |
cagcaatttggataagccaagctaagtaatgagaaccgaaccaagtgttg |
27541224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University