View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_high_59 (Length: 226)
Name: NF18683_high_59
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_high_59 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 31980899 - 31981118
Alignment:
| Q |
7 |
gcttctttgttaccttgctctcaacccaaagaatactcacaagttcattcttggtgcctttgccgatctcctcgttaccctcatgtcattctagtcatgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980899 |
gcttctttgttaccttgctctcaacccaaagaatactcacaagttcattcttggtgcttttgccgatctcctcgttaccctcatgtcattctagtcatgg |
31980998 |
T |
|
| Q |
107 |
ttttaaattgcagttgcggttgcactgcaataaaatgtaagcaaaaatggtcaatgcgaccaccatcccaattgtgataccgttgcagagatcgctagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
31980999 |
ttttaaattgcagttgcggttgcactgcaataaaatgtaagcaaaaatggtcaatgcgaccaccatcccaattgtgataccgttgcagagattgctaaaa |
31981098 |
T |
|
| Q |
207 |
ttgttatattacgactgcaa |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31981099 |
ttgttatattacgactgcaa |
31981118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University