View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_low_26 (Length: 350)
Name: NF18683_low_26
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 233 - 339
Target Start/End: Complemental strand, 39784977 - 39784871
Alignment:
| Q |
233 |
atagaaattcatcactataacacttcaaaataaatgcacctttctaaccgattcaaatgatctctcttgtatagaaattcattttagggatgtgataata |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784977 |
atagaaattcatcactataacacttcaaaataaatgcacctttctaaccgattcaaatgatctctcttgtatagaaattcattttagggatgtgataata |
39784878 |
T |
|
| Q |
333 |
atgaaaa |
339 |
Q |
| |
|
||||||| |
|
|
| T |
39784877 |
atgaaaa |
39784871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 39785181 - 39785095
Alignment:
| Q |
19 |
gaagcagcatgaggcgagcaaaagtttcaatgtggatgcttccggtcgttcgcctaactaaattctttgacgggagttgttccttat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39785181 |
gaagcagcatgaggcgagcaaaagtttcaatgtggatgcttccggtcgttcgcctaactagattctttgacgggagttgttccttat |
39785095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University