View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_low_31 (Length: 328)
Name: NF18683_low_31
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 139 - 253
Target Start/End: Original strand, 33457271 - 33457385
Alignment:
| Q |
139 |
atgtaacctacattttacattatagtctagttagtatatggagttctattttacattttacattatttcaatctcttaactaatttcgttccatagaaag |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33457271 |
atgtaacctacattttacattatagtctagttagtatatggagttctattttacattttacattatttcaatctcttaactaatttcgttccatagaaag |
33457370 |
T |
|
| Q |
239 |
aattgattagattac |
253 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33457371 |
aattgattagattac |
33457385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 14 - 99
Target Start/End: Original strand, 33457118 - 33457203
Alignment:
| Q |
14 |
gttatatgatatagggtttgactattcgctgcataaatgtttatagtgttagttcaatgaatggatttgattaataacctgcaact |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33457118 |
gttatatgatatagggtttgactattcgctgcataaatgtttttagtgttagttcaatgaatggatttgattaataacctgcaact |
33457203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University