View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_low_37 (Length: 296)
Name: NF18683_low_37
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 8 - 281
Target Start/End: Original strand, 6261355 - 6261628
Alignment:
| Q |
8 |
aaattatactatagtataactagaagacaagccaagggatcactaattctaaaaaataccaaaacctctctaccctcaatgcaaccaaacaaagacaagt |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261355 |
aaattatattatagtataactagaagacaagccaagggatcactaattctaaaaaataccaaaacctctctaccctcaatgcaaccaaacaaagacaagt |
6261454 |
T |
 |
| Q |
108 |
caatctttgtccaaatttaggaaacggatatccttccaaatggaagtttttggcactgaaatctcatccactcgttagtttatatcttatgcggtcacaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261455 |
caatctttgtccaaatttaggaaacggatatccttccaaatggaagtttttggcactgaaatctcatccactcgttagtttatatcttatgcggtcacaa |
6261554 |
T |
 |
| Q |
208 |
tcgtttaaaaagaattgttatgtaaattaagtaaatttgggttttggacaattcagattttagttggttgatga |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261555 |
tcgtttaaaaagaattgttatgtaaattaagtaaatttgggttttggacaattcagattttagttggttgatga |
6261628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University