View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_low_45 (Length: 277)
Name: NF18683_low_45
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 262
Target Start/End: Complemental strand, 24715391 - 24715142
Alignment:
| Q |
13 |
tgctgtgtcaatcgtcacagcctcataatcaattctcttcgacttattctctaaaatatatgaaaataatagtccttaatggtttataaacagtcccaat |
112 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24715391 |
tgctgtgtcaatcttcgcagcctcataatcaattctcttttacttattctctaaaatatatgaaaataatagtccttaatggtttataaacagtcccaat |
24715292 |
T |
|
| Q |
113 |
gttttgtcaaattcatcaaattagtcattattgttatatattaagaaaatgataggcactatcatgacagatttgacaaaacttcaaggactatttataa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24715291 |
gttttgtcaaattcatcaaattagtcattattgttatatattaagaaaatgataggcactatcatgacagatttgacaaaacttcaaggactatttataa |
24715192 |
T |
|
| Q |
213 |
aatgttagggtgttgaaagttgctccaggggatgaattgtaggtcagtct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24715191 |
aatgttagggtgttgaaagttgctccaggggatgaattgtaggtcagtct |
24715142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University