View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_low_48 (Length: 271)
Name: NF18683_low_48
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 9e-42; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 760842 - 760936
Alignment:
| Q |
1 |
tgataatcagatccctattatgataatgactgagcttataaattctggtatgaatgacaaggctgccactgtttttaccttagccaatgaatctc |
95 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
760842 |
tgataatcaaatccctattatgataatgactgagcttataaattctggtatgaatgacaaggctgccactgtttttaccttagccaatggatctc |
760936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 75
Target Start/End: Complemental strand, 1409009 - 1408955
Alignment:
| Q |
21 |
tgataatgactgagcttataaattctggtatgaatgacaaggctgccactgtttt |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
1409009 |
tgataatgactgagcttataaattctggtatgactgatgaggctgtcactgtttt |
1408955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 704567 - 704534
Alignment:
| Q |
1 |
tgataatcagatccctattatgataatgactgag |
34 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
704567 |
tgataatcaaatccctattatgataatgactgag |
704534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University