View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_low_52 (Length: 258)
Name: NF18683_low_52
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 242
Target Start/End: Complemental strand, 5304364 - 5304134
Alignment:
| Q |
12 |
ctcaaatttgaaggagttttagttgagtttagaatgctaaaattttgtcactttgatgagttttactttgctcgtttttatcttgtatttcaattgtaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5304364 |
ctcaaatttgaaggagttttagttgagtttagaatgctaaaattttgtcactttgatgagttttactttgctcgtttttatcttgtatttcaattgtaag |
5304265 |
T |
 |
| Q |
112 |
tgaggatagtaggacaaccttgtcttgttatgaaggatcaaatgagaaagtgttttgggatttaggagggaccatattttgcacagtttttggtttgttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5304264 |
tgaggatagtaggacaaccttgtcttgttatgaaggatcaaatgagaaagtgttttgggatttaggagggaccatattttgcacagtttctggtttgttg |
5304165 |
T |
 |
| Q |
212 |
ttgttcattgaatccatttatgaatggatat |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
5304164 |
ttgttcattgaatccatttatgaatgtatat |
5304134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 83
Target Start/End: Original strand, 16292577 - 16292656
Alignment:
| Q |
6 |
attatgctcaaatttgaaggagttttagttgagtttagaatgctaaaattttg--tcactttgatgagttttactttgct |
83 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||| |||||| ||||||||||||||| || |||||| |
|
|
| T |
16292577 |
attatgctcaaatttgaagggtcattagttgaacatagaatgctaagattttgtatcactttgatgagttctattttgct |
16292656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University