View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18683_low_55 (Length: 250)
Name: NF18683_low_55
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18683_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 39 - 237
Target Start/End: Original strand, 35602805 - 35602994
Alignment:
| Q |
39 |
gcatattgcttttatctgtttagtgaatccattgctcaagtgacaatggacatgggagtggtgttataggcttctcacaacttagtgtttcgactcttcc |
138 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35602805 |
gcatatttcttttatctgtttagtgaatccattgctcaagtgacaatggacatgggagtggtgttagaggcttctcacaacttagtgtttc--------- |
35602895 |
T |
 |
| Q |
139 |
acaaactccatgaaatcatcacagtcaatggttgttgttgggatgataacctatcaagcaaatcaaaaagcatatcagagaaaatgttaacactgagaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35602896 |
acaaactccatgaaatcatcacagtcaatggttgtggttgggatgataacctatcaagcaaatcaaaaagcatatcagagaaaatgttaacactgagaa |
35602994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 35601805 - 35601848
Alignment:
| Q |
1 |
ctggaccaactttacggatatcttgatttttgctcttcgcatat |
44 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
35601805 |
ctggaccaactttacggatatcatgatttttgctctttgcatat |
35601848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 35639209 - 35639173
Alignment:
| Q |
1 |
ctggaccaactttacggatatcttgatttttgctctt |
37 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35639209 |
ctggatcaactttacggatatcatgatttttgctctt |
35639173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University