View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18683_low_57 (Length: 248)

Name: NF18683_low_57
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18683_low_57
NF18683_low_57
[»] chr5 (1 HSPs)
chr5 (1-239)||(39934833-39935069)


Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 39934833 - 39935069
Alignment:
1 gttgtgaagtgtgatggtagagtgtatatgcttttggaaaagcgatcgactaccaccactaagatgattgtgtacgcattggaagatggcagtcccgtga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39934833 gttgtgaagtgtgatggtagagtgtatatgcttttggaaaagcgatcgactaccaccactaagatgattgtgtacgcattggaagatggcagtcccgtga 39934932  T
101 tgaaatctaatgaaatatcctcccaaacattggc-----tggaataggaaggggctatagaagaccaacggggcttggtgtcgtacttggtagttggtat 195  Q
    ||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||       |||||||    
39934933 tgaaatctaatgaaatatcctcccaaacattggctggaatggaataggaaggggctatagaagaccaacggggcttggtgtcgtac-------ttggtat 39935025  T
196 gttgacaaatcacaaaattcttgataaaactttgaatgtctctg 239  Q
    |||||||||||||| |||||||||||||||||||||||||||||    
39935026 gttgacaaatcacacaattcttgataaaactttgaatgtctctg 39935069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University