View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18683_low_65 (Length: 231)

Name: NF18683_low_65
Description: NF18683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18683_low_65
NF18683_low_65
[»] chr5 (1 HSPs)
chr5 (20-169)||(27541224-27541373)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 20 - 169
Target Start/End: Complemental strand, 27541373 - 27541224
Alignment:
20 gatggctacttgaacagaaggnnnnnnnngaggatatggttaaaaagacagacaagtaatgtatggttgtaatggccatctatgagactattcccaccat 119  Q
    |||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27541373 gatggctacttgaacagaagggaaaaaaagaggatatggttaaaaagacagacaagtaatgtatggttgtaatggccatctatgagactattcccaccat 27541274  T
120 cagcaatttggataagccaagctaagtaatgagaaccgaaccaagtgttg 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
27541273 cagcaatttggataagccaagctaagtaatgagaaccgaaccaagtgttg 27541224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University