View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18684_high_25 (Length: 309)
Name: NF18684_high_25
Description: NF18684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18684_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 41 - 300
Target Start/End: Original strand, 15293468 - 15293724
Alignment:
| Q |
41 |
aattggagtttatgattagatcaccgatatgcaacacacggctacacctcttactcaagaggtacttctcacttgttgatacacgaacattggtgccaat |
140 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15293468 |
aattagagtttatgattagatcaccgatatgcaacacacggttacacctcttactcaagaggtacttctcacttgttgatacacgaacattggtgccaat |
15293567 |
T |
 |
| Q |
141 |
cgcggaacctcaataaaacttatacctaggcctcaagattccacattatggaaagaatcaaaatccatattccataggaaaatttctggtagtttatgat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15293568 |
cgcggaacctcaataaaacttatacctaggcctcaagattccacattatggaaagaaccaaaattcatattccataggaaaatttctggtagtttatgat |
15293667 |
T |
 |
| Q |
241 |
ggataaatttagcaagtgtactgatcttttgttcaagtagttatatttataagttcatct |
300 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15293668 |
ggataaatttagcaa---tactgatcttttgttcaagtagttatatttataagttcatct |
15293724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University