View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18684_low_24 (Length: 325)
Name: NF18684_low_24
Description: NF18684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18684_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 47875294 - 47875111
Alignment:
| Q |
18 |
ctttcaactcctcttccagcctcctgttctcttctgttagagtttcataacaatgcttcagtgcctcacagtccacttctgtttgtttcacctttgtcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875294 |
ctttcaactcctcttccagcctcctgttctcttctgttagagtttcataacaatgcttcagtgcctcacagtccacttctgtttgtttcacctttgtcct |
47875195 |
T |
|
| Q |
118 |
gcatatattatatcttaattaaacatgattattacatatatataagaattttatttgtatgcacctacgtcgtgtaacatgcatttaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47875194 |
gcatatattatatcttaattaaacatgattattaca----tataagaattttatttgtatgcacctacgttgtgtaacatgcatttaa |
47875111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 207 - 320
Target Start/End: Complemental strand, 47875045 - 47874932
Alignment:
| Q |
207 |
gagaataatgattgtaaatatagaattacaaccttgccctcctgttctgaaaccacacctccacttgtctcgtcccaagattcagcttgcttgccaattc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875045 |
gagaataatgattgtaaatatagaattacaaccttgccctcctgttctgaaaccacacctccacttgtctcgtcccaagattcagcttgcttgccaattc |
47874946 |
T |
|
| Q |
307 |
ttgcctttgcttct |
320 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
47874945 |
ttgcttttgcttct |
47874932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University