View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18684_low_37 (Length: 233)
Name: NF18684_low_37
Description: NF18684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18684_low_37 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 233
Target Start/End: Complemental strand, 35916461 - 35916246
Alignment:
| Q |
14 |
gtcttaacttggtcttcaccaattcaggatcatcccctacattgcacaaagatgcaaacccgcaacctcgtcagcaaaactatacatgcatttaatctat |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35916461 |
gtcttaatttggtcttcaccaattcaggatcatcccctacattgcacaaagatgcaaacccgcaacctcgtcagcaaaactatacatgcatttaatatat |
35916362 |
T |
 |
| Q |
114 |
taatttgtataattttttgccaataatgtataagacaaacacattgagatgttaaaaaataggnnnnnnnnnnnnntatcggtaagaactcctgaccgaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35916361 |
taatttgtataattttttgccaataatgtataagacaaacacattgagatgttaaaaaatagg----tatatatattatcggtaagaactcctgaccgaa |
35916266 |
T |
 |
| Q |
214 |
ttctgaattatcgcagtctt |
233 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35916265 |
ttctgaattatcgcagtctt |
35916246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University