View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18684_low_38 (Length: 227)
Name: NF18684_low_38
Description: NF18684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18684_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 41825157 - 41824961
Alignment:
| Q |
13 |
aagaatatcattaactcttttataccttttgttcaaatcattgaacttgtcttcacattgttgaggtgaaacatagtaccccttttccatcattcctttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41825157 |
aagaatatcattaactcttttataccttttgttcaaatcattgaacttgtcttcacattgttgaggtgaaacatagtaccctttttccatcattcctttg |
41825058 |
T |
|
| Q |
113 |
gaaactgatttccatttccctttcttttgtaataaaccattagctttctttttatcagcacttaattctgaagtaccagcttcatcaccaatgtaat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825057 |
gaaactgatttccatttccctttcttttgtaataaaccattagctttctttttatcagcacttaattctgaagtaccagcttcatcaccaatgtaat |
41824961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 17 - 151
Target Start/End: Original strand, 26920131 - 26920265
Alignment:
| Q |
17 |
atatcattaactcttttataccttttgttcaaatcattgaacttgtcttcacattgttgaggtgaaacatagtaccccttttccatcattcctttggaaa |
116 |
Q |
| |
|
|||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||||||||||||||| ||||| |||| ||||||||||| | | |||| |
|
|
| T |
26920131 |
atatcattcactctcttataccttttattcaaatcattaaacttatcttcacattgttgaggtgacacataaaaccctttttccatcatagcccttgaaa |
26920230 |
T |
|
| Q |
117 |
ctgatttccatttccctttcttttgtaataaacca |
151 |
Q |
| |
|
| |||||||| || || ||||| ||||| |||||| |
|
|
| T |
26920231 |
cagatttccactttcccttcttctgtaacaaacca |
26920265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University