View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18685_high_8 (Length: 316)
Name: NF18685_high_8
Description: NF18685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18685_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 25296375 - 25296675
Alignment:
| Q |
1 |
ttcttcttccgccatgactcgttccaatccacaaggtatttttctctctctaatcttcattttctgttatggtttgattctctgatccgtgcaatatgat |
100 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296375 |
ttcttcctccaccatgactcgttccaatccacaaggtatttttctctctctaatcttcattttctgttatggtttgattctctgatccgtgcaatatgat |
25296474 |
T |
 |
| Q |
101 |
cctatgatttcttttttaatattcttttattgcttactctagctataataattttaacctaagtttttatattgtgacagataaaattggaaacatgcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296475 |
cctatgatttcttttttaatattcttttattgcttactctatctataataattttaaccaaagtttttatattgtgacagataaaattggaaacatgcct |
25296574 |
T |
 |
| Q |
201 |
tcatattttgatttgccaccacttgatgtttctcttgcatttccacaagcaactccagcatctacttttcctccttgtggtaacaacctaatcacatact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296575 |
tcatattttgatttgccaccacttgatgtttctcttgcatttccacaagcaactccagcatctacttttcctccttgtggtaacaacctaatcacatact |
25296674 |
T |
 |
| Q |
301 |
t |
301 |
Q |
| |
|
| |
|
|
| T |
25296675 |
t |
25296675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University