View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18686_low_20 (Length: 279)

Name: NF18686_low_20
Description: NF18686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18686_low_20
NF18686_low_20
[»] chr1 (1 HSPs)
chr1 (17-260)||(43451322-43451564)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 260
Target Start/End: Original strand, 43451322 - 43451564
Alignment:
17 ataatgagtttaacgaatattgcataactaaaagaccaaaaatgaataagtgcaacatgtcaaatggcagaatttaagaacaaacaagttgtataccttg 116  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
43451322 ataatgagtttaacgaatactgcataactaaaagaccaaaaatgaataagtggaacatgtcaaatggcagaatttaagaacaaacaagttgtataccttg 43451421  T
117 tcgttaacgttggcacctttgagcctctgaacaacaagccagcggccaggatgaacaatatattggcgcccaccaatctaaacaaaacaacacaagaaaa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43451422 tcgttaacgttggcacctttgagcctctgaacaacaagccagcggccaggatgaacaatatattggcgcccaccaatctaaacaaaacaacacaagaaaa 43451521  T
217 tattaaaaaagcacaagtacagaacataaaatttgagacagaga 260  Q
    |||| |||||||| ||| ||||||||||||||||||||||||||    
43451522 tatt-aaaaagcaaaagaacagaacataaaatttgagacagaga 43451564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University