View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18686_low_26 (Length: 249)
Name: NF18686_low_26
Description: NF18686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18686_low_26 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 101 - 249
Target Start/End: Complemental strand, 5969268 - 5969120
Alignment:
| Q |
101 |
gcactatagattgtcccaaaactgtaacgcaggctaatagtcaaagttaggcatgtgatttctaatatgtgatatacagacaagtgtgtgtcagataagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5969268 |
gcactatagattgtcccaaaactgtaacgcaggctaatagtcaaagttaggcatgtgatttctaatatgtgatatacagacaagtgtgtgtcagataagg |
5969169 |
T |
|
| Q |
201 |
ttatcttaaaggacattagagtataaatgtaaaatgtatggtttctggc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5969168 |
ttatcttaaaggacattagagtataaatgtaaaatgtatggattctggc |
5969120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 5969318 - 5969266
Alignment:
| Q |
18 |
ggtctcacccattttcctacgctaaaattaaaatttcttaggcttccatggca |
70 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5969318 |
ggtctcacccattttcctaccctaaaattaaaatttcttaggcttccatggca |
5969266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University