View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18686_low_28 (Length: 231)
Name: NF18686_low_28
Description: NF18686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18686_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 37300521 - 37300734
Alignment:
| Q |
1 |
tgcaacagtcaatagagatccaccaccatgtccagtttcaccaacacctcctccatttgtggttgtcccatctggtagtatagcaaatccagatggaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37300521 |
tgcaacagtcaatagagatccaccaccatgtccagtttcaccaacacctcctccatttgtggttgtcccatctggtagtatagcaaatccagatggaaga |
37300620 |
T |
|
| Q |
101 |
agtgctacataatctggatcccctccatttagaaccacattcattgcaactatgtctacaggtgcatatatcacaaatgaccctgttgtatccgtacagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37300621 |
agtgctacataatctggatcccctccatttagaaccacattcattgcaactatgtctacaggtgcatatatcacaaatgaccctgttgtatccgtacaac |
37300720 |
T |
|
| Q |
201 |
tctcttgcaatatc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37300721 |
tctcttgcaatatc |
37300734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 80 - 188
Target Start/End: Complemental strand, 16829072 - 16828964
Alignment:
| Q |
80 |
atagcaaatccagatggaagaagtgctacataatctggatcccctccatttagaaccacattcattgcaactatgtctacaggtgcatatatcacaaatg |
179 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| |||||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||| |
|
|
| T |
16829072 |
atagcaaatcctgatggaagaagtgcaacataatctggatctcctccatttagaactacattcatagcaaccatatctactggcgcatagataacaaatg |
16828973 |
T |
|
| Q |
180 |
accctgttg |
188 |
Q |
| |
|
| ||||||| |
|
|
| T |
16828972 |
agcctgttg |
16828964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University