View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18686_low_29 (Length: 214)
Name: NF18686_low_29
Description: NF18686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18686_low_29 |
 |  |
|
| [»] scaffold0115 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0115 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 33 - 199
Target Start/End: Original strand, 33520 - 33687
Alignment:
| Q |
33 |
gattatgtgatcaacgaatttaagagtttagaaatatgaaaaattaactaatttgaatagagaa-tgatgagatcattgtttatgtttacttgaaataca |
131 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33520 |
gattatgtgatcaaagaatttaagagtttagaaatatgaaaaactaactaatttgaatagagaattgatgagatcattgtttatgtttacttgaaataca |
33619 |
T |
 |
| Q |
132 |
aaatattgggtgnnnnnnnntagggagagaaactaacacaggcttacagaaaatagatacaaggaagt |
199 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33620 |
aaatattgggtgaagaaaaatagggagagaaactaacacaggcttacagaaaatagatacaaggaagt |
33687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University