View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18687_low_14 (Length: 268)
Name: NF18687_low_14
Description: NF18687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18687_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 253
Target Start/End: Original strand, 1512711 - 1512960
Alignment:
| Q |
14 |
aacatccagaaaacgtaaagatgaagaaatgacaacatcagtcatgctgg---------------------atagattacttggttcatcgaaaactcca |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
1512711 |
aacatccagaaaacgtaaagatgaagaaatgacaacatcagtcatgctgggaagaataactcgttcaacggatagattacttcgttcatcgaaaactcca |
1512810 |
T |
|
| Q |
93 |
cattccaagcttttcgcgttacaagatcagtcgcatagtaataagaagatgtagaaaaaagcggaaggttatgtggttgaagctgaattctctaagaagg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1512811 |
cattccaagcttttcgcgttacaagatcagtcgcatagtaagaagaagatgtagaa-----------gttatgtggttgaagctgaattctctaagaagg |
1512899 |
T |
|
| Q |
193 |
ttgcagaatcttctacttaccaaagatatgaaacaattatcgctcaacattagtaaatatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1512900 |
ttgcagaatcttctacttaccaaagatatgaaacaattatcgctcaacattagtaaatatt |
1512960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University