View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18687_low_9 (Length: 340)
Name: NF18687_low_9
Description: NF18687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18687_low_9 |
 |  |
|
| [»] scaffold0125 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 275 - 324
Target Start/End: Complemental strand, 10659354 - 10659305
Alignment:
| Q |
275 |
caattgtgcaagtggtgggtcctatctaattgtcggatttaatttatttg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10659354 |
caattgtgcaagtggtgggtcctatctaattgtcggatttaatttatttg |
10659305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 275 - 324
Target Start/End: Complemental strand, 10873499 - 10873450
Alignment:
| Q |
275 |
caattgtgcaagtggtgggtcctatctaattgtcggatttaatttatttg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10873499 |
caattgtgcaagtggtgggtcctatctaattgtcggatttaatttatttg |
10873450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0125 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0125
Description:
Target: scaffold0125; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 273 - 327
Target Start/End: Original strand, 20814 - 20868
Alignment:
| Q |
273 |
ctcaattgtgcaagtggtgggtcctatctaattgtcggatttaatttatttgata |
327 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
20814 |
ctcaattgtgcaagtggtgggtcctatattattctcggatttaatttatttgata |
20868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 273 - 320
Target Start/End: Complemental strand, 21843129 - 21843082
Alignment:
| Q |
273 |
ctcaattgtgcaagtggtgggtcctatctaattgtcggatttaattta |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
21843129 |
ctcaattgtgcaagtggtgggtcctatctaattattggatttaattta |
21843082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University