View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18688_low_7 (Length: 239)
Name: NF18688_low_7
Description: NF18688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18688_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 10 - 155
Target Start/End: Complemental strand, 47043702 - 47043557
Alignment:
| Q |
10 |
catcatcaagtagccacaccgtagttgttgtagttgcaagttggacgtctctaactttaactctcaggttttggaatttgttataatgatgactattttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47043702 |
catcatcaagtagccacaccgtagttgttgtagttgcaagttggacgtctctaactttaactctcaggttttggaatttgttataatgatgactattttt |
47043603 |
T |
 |
| Q |
110 |
tgtatttatgaatgttattttcagtttaaatagaagattattcttt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47043602 |
tgtatttatgaatgttattttcagtttaaatagaagattattcttt |
47043557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 47043528 - 47043475
Alignment:
| Q |
186 |
gtcaggattacatttttattttatcaatgcatatttttactatgataacgtgac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47043528 |
gtcaggattacatttttattttatcaatgcatatttttactatgataacgtgac |
47043475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 155
Target Start/End: Complemental strand, 17902328 - 17902294
Alignment:
| Q |
121 |
atgttattttcagtttaaatagaagattattcttt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
17902328 |
atgttattttcaatttaaatagaagattattcttt |
17902294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Complemental strand, 1112536 - 1112500
Alignment:
| Q |
119 |
gaatgttattttcagtttaaatagaagattattcttt |
155 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
1112536 |
gaatgttattttcaatttaaatagaagattaatcttt |
1112500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 23688420 - 23688387
Alignment:
| Q |
122 |
tgttattttcagtttaaatagaagattattcttt |
155 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
23688420 |
tgttattttcaatttaaatagaagattattcttt |
23688387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University