View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18689_high_28 (Length: 239)
Name: NF18689_high_28
Description: NF18689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18689_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 88 - 202
Target Start/End: Original strand, 3643247 - 3643361
Alignment:
| Q |
88 |
ctcctcatcttcttcctcaaactcattctcaaaatatctttcctctcaatcaacctatcaatgcttctgctgctcagtaagttcctttcattcttctctt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3643247 |
ctcctcatcttcttcctcaaactcattctcaaaatatctttcctctcaatcaacctatcaatgcttctgctgctcagtaagttcctttcattcttctctt |
3643346 |
T |
 |
| Q |
188 |
gttggtattaattag |
202 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3643347 |
gttggtattaattag |
3643361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 3643148 - 3643223
Alignment:
| Q |
19 |
accactgccaacactgtcccctccgccatcattgccaccactgcccactccacaacaacaaccccaaccctcctca |
94 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3643148 |
accactgccaacactgtccccttcgccatcattgccaccactgcccactccacaacaacaaccccaaccctcctca |
3643223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University