View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18689_low_13 (Length: 377)
Name: NF18689_low_13
Description: NF18689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18689_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 8 - 231
Target Start/End: Original strand, 29791747 - 29791980
Alignment:
| Q |
8 |
tgtgttccgaaagacgacaaaacttggtttaaatttcacaatcatgtcaatctaacaatgtttatgttgaagtttttcct----------tggtatatga |
97 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||| |||||| |||||||||| |
|
|
| T |
29791747 |
tgtgttcccaaagacgacaaaacttagtttaaatttcacaatcatgtcaatctaacaatgtttctattgaagtatttcctatgcattttgtggtatatga |
29791846 |
T |
 |
| Q |
98 |
tatgagcacggggtgattctctagtaaggcattgtgaagtttttcccattcaccccttctttgcacattggaccactcaccttcatttcttacatacttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
29791847 |
tatgagcacggggtgattctctagtaaggcattttgaagtttttcccattcaccccttatttgcacattcgaccactcaccttcatctcttacatacttc |
29791946 |
T |
 |
| Q |
198 |
tcttggtcatctagtatggagaggttggtctatg |
231 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
29791947 |
tcttggttatctagtatggagaggttggtctatg |
29791980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University