View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18689_low_20 (Length: 320)
Name: NF18689_low_20
Description: NF18689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18689_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 13 - 301
Target Start/End: Original strand, 44725201 - 44725489
Alignment:
| Q |
13 |
aatattggcattactcgaaaataaccctagtttgagccaattaatcggatttgtgttggataagaactcggcattagagaagccaaaagcttgccaaaga |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44725201 |
aatattggcattacttgaaaataaccctagtttgagccaattaatcggatttgtgttggataagaactcggcattagagaagccaaaagcttgccaaaga |
44725300 |
T |
|
| Q |
113 |
gaacgagaggctaatggatctctaatgcactgaaggaaagattcttcttccgaattgaactgatggcaatgctattgggagccatgttacaatgatgaag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44725301 |
gaacgagaggctaatggatctctaatgcactgaaggaaatattcttcttccgaattgaactgatggcaatgctattgggagccatgttacaatgatgaag |
44725400 |
T |
|
| Q |
213 |
caaaggaatcattgttacaaagttgttacaagtcaaccatacaagaaactagatcttttcaggcaaatggagtcgtcatatccaagact |
301 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44725401 |
caaagggatcattgttacaaagttgttacaagtcaaccatacaagaaactagatcttttcaggcaaatgaagtcgtcatatccaagact |
44725489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University