View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18689_low_21 (Length: 299)
Name: NF18689_low_21
Description: NF18689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18689_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 179 - 248
Target Start/End: Complemental strand, 31647688 - 31647619
Alignment:
| Q |
179 |
aaaataaaagtgccacatgggggtggtagagtgggtgtatgagaaaaagaatgtccatggataattatcc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31647688 |
aaaataaaagtgccacatgggggtggtagagtgggtgtatgagaaaaagaatgtccatggataattatcc |
31647619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 31647841 - 31647775
Alignment:
| Q |
26 |
cgtcctccgtcgttccccaccttccttcgtcgtcggtaatgg-gggtttgtgttgggatctcgtcgg |
91 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31647841 |
cgtcctccgtcgttccccaccttccttcgccgtcggtaatggagggtttgtgttgggatctcgtcgg |
31647775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University