View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18690_high_20 (Length: 239)
Name: NF18690_high_20
Description: NF18690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18690_high_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 52805990 - 52806200
Alignment:
| Q |
17 |
actgacaaactaaagtgaagcagnnnnnnnngactcttcttcatatatttgccttactaccaaccaacaatgcttttagcatgtgttctgccatagctca |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52805990 |
actgacaaactaaagtgaagcagaaaagaaagactcttcttcatatatttgccttactaccaaccaacaatgcttttagcatgtgttctgccatagctca |
52806089 |
T |
 |
| Q |
117 |
gtaaccgtacataatcctcaacaaattgcacaacaaattaatcacctttcaaaaacaccatcagaactagacaacacttttagttttatgtacttatgtt |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52806090 |
gtaaccgtacataatcct------------caacaaattaatcacctttcaaaaacaccatcagaactagacaacacttttagttttatgtacttatgtt |
52806177 |
T |
 |
| Q |
217 |
tacctttcttttttggttgcatt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52806178 |
tacctttcttttttggttgcatt |
52806200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University