View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18692_high_7 (Length: 261)
Name: NF18692_high_7
Description: NF18692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18692_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 89 - 244
Target Start/End: Original strand, 4831518 - 4831673
Alignment:
| Q |
89 |
attgatgaaaactcgcgtcaacattgtatttcaacgaccttggatcaggcctcttccaaatgtcaatgtgttacgacggtcctgggaagatttcaactcg |
188 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4831518 |
attgatgaaaactcgcatcaacattgtatttcaacgaccttggatcaggcctcttccaaatgccaatgtgtcacgacggtcctgggaagatttcaactcg |
4831617 |
T |
|
| Q |
189 |
tcccgcttttgctgaacgttaacacatatttgttgcacattgagttgacattaaaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
4831618 |
tcccgcttttgctgaacgttaacacatatttgttgcatattgaattgacattaaaa |
4831673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 60
Target Start/End: Original strand, 4809355 - 4809403
Alignment:
| Q |
12 |
atgaaggaatgattggaaacatgagtgaatttacaataaagtaaaaggt |
60 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||| | ||||||||| |
|
|
| T |
4809355 |
atgaaggcatgattggaaacatgactgaatttacaattacgtaaaaggt |
4809403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 239
Target Start/End: Original strand, 6803187 - 6803237
Alignment:
| Q |
189 |
tcccgcttttgctgaacgttaacacatatttgttgcacattgagttgacat |
239 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||| |||| |||| |||| |
|
|
| T |
6803187 |
tcccacttttgccgaacgttaacacatatttgttgcgcattaagtttacat |
6803237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University