View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18692_high_9 (Length: 241)
Name: NF18692_high_9
Description: NF18692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18692_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 118 - 228
Target Start/End: Complemental strand, 43605480 - 43605370
Alignment:
| Q |
118 |
atactagtaaaagtcatccggttttagtaaatatcaacaactataaaccggtttcttgtggtttaagaaatcaaatgtctgaacagaagtcccagtcaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43605480 |
atactagtaaaagtcatccggttttagtaaatatcaacaactataaaccggtttcttgtggtttaagaaatcaaatgtctgaacagaagtcccagtcaca |
43605381 |
T |
 |
| Q |
218 |
gtagtggataa |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
43605380 |
gtagtggataa |
43605370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 43605597 - 43605545
Alignment:
| Q |
1 |
acacaaacatttgttaatggatcttggccatatcgtatcttgctttctaaaac |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43605597 |
acacaaacatttgttaatggatcttggccatatcgtatcttgctttctaaaac |
43605545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University