View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18692_low_4 (Length: 351)
Name: NF18692_low_4
Description: NF18692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18692_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 10 - 333
Target Start/End: Complemental strand, 48568512 - 48568201
Alignment:
| Q |
10 |
aagaaaatggacactttcttacttccaaggaagacgaggacaataaccaagacaataaccaagttgacatgatggcatttcttatatagcattcatttcc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568512 |
aagaaaatggacactttcttacttccaaggaagacgaggacaataaccaag------------ttgacatgatggcatttcttatatagcattcatttcc |
48568425 |
T |
|
| Q |
110 |
cttattatactccagattttttattacattttcttgctttaaatcacacgagtgattagtctgcttaaattggtgcacacctttgatcattgcttttgtc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568424 |
cttattatactccagattttttattacattttcttgctttaaatcacacgagtgattagtctgcttaaattggtgcacacctttgatcattgcttttgtc |
48568325 |
T |
|
| Q |
210 |
tgcttcagcgactcgtggtgctggtacatagtcaatctgataatcacctttccccctggaagtaacataattttcacaaggatagatgaaaagaaatgta |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568324 |
tgcttcagtgactcgtggtgctggtacatagtcaatctgataatcacctttccccctggaagtaacataattttcacaaggatagatgaaaagaaatgta |
48568225 |
T |
|
| Q |
310 |
tctgtagtttgcaaagtgtgacat |
333 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48568224 |
tctgtagtttgcaaagtgtgacat |
48568201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 178 - 270
Target Start/End: Original strand, 10822963 - 10823055
Alignment:
| Q |
178 |
attggtgcacacctttgatcattgcttttgtctgcttcagcgactcgtggtgctggtacatagtcaatctgataatcacctttccccctggaa |
270 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||| | || ||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10822963 |
attggtgcataccttcgatcattttgtttgtctgcttcggtgattcgcggtgctggcacatagtcaatctgataatcacctttccccctggaa |
10823055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 162 - 270
Target Start/End: Complemental strand, 36144389 - 36144282
Alignment:
| Q |
162 |
tgattagtctgcttaaattggtgcacacctttgatcattgcttttgtctgcttcagcgactcgtggtgctggtacatagtcaatctgataatcacctttc |
261 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||| ||||||| |||||||||||| | || ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36144389 |
tgatcagtctgct-aaattggtgcataccttcgatcattttgtttgtctgcttcggtgattcgcggtgctggcacatagtcaatctgataatcacctttc |
36144291 |
T |
|
| Q |
262 |
cccctggaa |
270 |
Q |
| |
|
|| |||||| |
|
|
| T |
36144290 |
cctctggaa |
36144282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University