View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18693_high_11 (Length: 440)
Name: NF18693_high_11
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18693_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 6e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 123 - 217
Target Start/End: Original strand, 9692620 - 9692714
Alignment:
| Q |
123 |
tgatcttggtatcttatcttatttcatagaaatggaatttaagataaaagcacaaggatttctagttcatcatggaaggtatgctcgagacatat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692620 |
tgatcttggtatcttatcttatttcatagaaatggaatttaagataagagcacaaggatttctagttcatcatggaaggtatgctcgagacatat |
9692714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 9692553 - 9692622
Alignment:
| Q |
1 |
actcaacaaataagcacaaactaattgtaagctaaatatgttggtgacatgattgtgaccggcaacaatga |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9692553 |
actcaacaaataagcacaaactaattgtaagct-aatatgttggtgacgtgattgtgaccggcaacaatga |
9692622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University