View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18693_high_39 (Length: 246)
Name: NF18693_high_39
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18693_high_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 26585611 - 26585824
Alignment:
| Q |
16 |
atccatgtcaaacaaacttttgtttggtttgctctcctcacaaaatcaccaagttttggagctggtgacaatgatatgggatcagttatgtatggcataa |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26585611 |
atccatgttaaacaaacttttgtttggttttctctcctcacaaaatcaccaagttttggagttggtgacaacgatatgggatcagttatgtatggcataa |
26585710 |
T |
|
| Q |
116 |
caatgttaattactgggtctaagtccgtcatggttataatggaatgaatgagactgaatttgattatagagaaagaattgcaatgggaatttaagagaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26585711 |
caatgttaattactgggtctaagtccgtcatggttataatggaatgaatgagattgaagttgattatagagaaagaattgcaatgggaatttaagagaaa |
26585810 |
T |
|
| Q |
216 |
gaatagagcaaagt |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26585811 |
gaatagagcaaagt |
26585824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 26585261 - 26585309
Alignment:
| Q |
20 |
atgtcaaacaaacttttgtttggtttgctctcctcacaaaatcaccaag |
68 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
26585261 |
atgtcaaacaaactttggtttggtttggcctcctcacaaaatcaccaag |
26585309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 86
Target Start/End: Original strand, 8288342 - 8288412
Alignment:
| Q |
16 |
atccatgtcaaacaaacttttgtttggtttgctctcctcacaaaatcaccaagttttggagctggtgacaa |
86 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288342 |
atccatgtcaaacaaactttggtttggcttggtctcctcacaaaatcaccaagttttggagctggtgacaa |
8288412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 19828472 - 19828520
Alignment:
| Q |
38 |
tttggtttgctctcctcacaaaatcaccaagttttggagctggtgacaa |
86 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19828472 |
tttggtttggtctcctcacaaaatcaccaagttttggagctggtgacaa |
19828520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University