View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18693_high_40 (Length: 240)
Name: NF18693_high_40
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18693_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 17 - 164
Target Start/End: Complemental strand, 11088930 - 11088784
Alignment:
| Q |
17 |
agaacttatatcagttccatacatagaaaacaaggttgataattcattactcaaccttatgctctaatgacaaagttgtttaaggctacgtatttttatc |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11088930 |
agaacttgtatcagttccatacatagaaaacaaggttgataattcattactcaaccttatgctctaatgacaaagttgtttaaggctacgtatttttatc |
11088831 |
T |
|
| Q |
117 |
gtgtgctgattttttgaatgcccatatcggtcataatccttcttattt |
164 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
11088830 |
gtgtgctgatttttt-aatgcccatatcggtcataatctttcttattt |
11088784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 192
Target Start/End: Complemental strand, 2160375 - 2160310
Alignment:
| Q |
126 |
ttttttgaatgcccatatcggtcataatccttcttattttttggtgaagtttatggtctacacgagc |
192 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| || ||||||||| |||||||| ||| |||| |
|
|
| T |
2160375 |
ttttttgaatgctcatattggtcataatccttctta-ttcttggtgaagcttatggtccacaagagc |
2160310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University