View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18693_high_46 (Length: 219)
Name: NF18693_high_46
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18693_high_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 29731722 - 29731774
Alignment:
| Q |
30 |
aacaaccatcataaataacaacatgccatgttccaatgtactcgaatttaaac |
82 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29731722 |
aacaaccatgataaataacaacatgccatgttccaatgtactcgaatttaaac |
29731774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University