View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18693_high_46 (Length: 219)

Name: NF18693_high_46
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18693_high_46
NF18693_high_46
[»] chr5 (1 HSPs)
chr5 (30-82)||(29731722-29731774)


Alignment Details
Target: chr5 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 29731722 - 29731774
Alignment:
30 aacaaccatcataaataacaacatgccatgttccaatgtactcgaatttaaac 82  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
29731722 aacaaccatgataaataacaacatgccatgttccaatgtactcgaatttaaac 29731774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University