View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18693_low_30 (Length: 301)
Name: NF18693_low_30
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18693_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 31 - 283
Target Start/End: Complemental strand, 3061204 - 3060955
Alignment:
| Q |
31 |
gtcgaaattgccactgtatggggtcttgtcttgtctgattcgagtgaagtgcggccactacaaaaactatacaacacgaaacagactgattcatagtacc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3061204 |
gtcgaaattgccactgtatggggtcttgtcttgtctgattcgagtgaagtgcggccattacaaaaactatacaacacgaaagagactgattcatagtacc |
3061105 |
T |
|
| Q |
131 |
atctttttcttcttctgttatggtaagagttttcctgaatcaattctctcaaatttcaaattaggtctttcttcatcgctaatcacttgttaattgcagg |
230 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3061104 |
atctt---cttcttctgttatggtaagagttttcctgaatcaattctctgaaatttcaaattaggtctttcttcatcgctaatcacttgttaattgcagg |
3061008 |
T |
|
| Q |
231 |
ctaataggaatcatcacacgattattctacttcaaacttctcaccacagagct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3061007 |
ctaataggaatcatcacacgattattctacttcaaacttctcaccacagagct |
3060955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University